|
Illumina Inc
150-nucleotide paired-end illumina barcode sequencing 150 Nucleotide Paired End Illumina Barcode Sequencing, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/150-nucleotide paired-end illumina barcode sequencing/product/Illumina Inc Average 90 stars, based on 1 article reviews
150-nucleotide paired-end illumina barcode sequencing - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Illumina Inc
8-nucleotide barcoded primers 8 Nucleotide Barcoded Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/8-nucleotide barcoded primers/product/Illumina Inc Average 90 stars, based on 1 article reviews
8-nucleotide barcoded primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Illumina Inc
10-nucleotide indexing set of barcodes 10 Nucleotide Indexing Set Of Barcodes, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/10-nucleotide indexing set of barcodes/product/Illumina Inc Average 90 stars, based on 1 article reviews
10-nucleotide indexing set of barcodes - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
StarSEQ GmbH
nucleotide blast analysis of the mitochondrial dna barcoding marker gene cytochrome c oxidase i (coi) Nucleotide Blast Analysis Of The Mitochondrial Dna Barcoding Marker Gene Cytochrome C Oxidase I (Coi), supplied by StarSEQ GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nucleotide blast analysis of the mitochondrial dna barcoding marker gene cytochrome c oxidase i (coi)/product/StarSEQ GmbH Average 90 stars, based on 1 article reviews
nucleotide blast analysis of the mitochondrial dna barcoding marker gene cytochrome c oxidase i (coi) - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
fluidigm
nucleotides barcode tacggtagcagagacttggtct 3 Nucleotides Barcode Tacggtagcagagacttggtct 3, supplied by fluidigm, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nucleotides barcode tacggtagcagagacttggtct 3/product/fluidigm Average 97 stars, based on 1 article reviews
nucleotides barcode tacggtagcagagacttggtct 3 - by Bioz Stars,
2026-04
97/100 stars
|
Buy from Supplier |
|
Biotechnology Information
dna barcodes available in the national center for biotechnology information nucleotide database Dna Barcodes Available In The National Center For Biotechnology Information Nucleotide Database, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dna barcodes available in the national center for biotechnology information nucleotide database/product/Biotechnology Information Average 90 stars, based on 1 article reviews
dna barcodes available in the national center for biotechnology information nucleotide database - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
fluidigm
nucleotides barcode tac ggt agc aga gac ttg gtct 3ʹ Nucleotides Barcode Tac Ggt Agc Aga Gac Ttg Gtct 3ʹ, supplied by fluidigm, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nucleotides barcode tac ggt agc aga gac ttg gtct 3ʹ/product/fluidigm Average 97 stars, based on 1 article reviews
nucleotides barcode tac ggt agc aga gac ttg gtct 3ʹ - by Bioz Stars,
2026-04
97/100 stars
|
Buy from Supplier |
|
fluidigm
barcode nucleotide sequences Barcode Nucleotide Sequences, supplied by fluidigm, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/barcode nucleotide sequences/product/fluidigm Average 97 stars, based on 1 article reviews
barcode nucleotide sequences - by Bioz Stars,
2026-04
97/100 stars
|
Buy from Supplier |
|
Illumina Inc
sequencing adaptors with unique barcode nucleotides Sequencing Adaptors With Unique Barcode Nucleotides, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sequencing adaptors with unique barcode nucleotides/product/Illumina Inc Average 90 stars, based on 1 article reviews
sequencing adaptors with unique barcode nucleotides - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |