Review





Similar Products

90
Illumina Inc 150-nucleotide paired-end illumina barcode sequencing
150 Nucleotide Paired End Illumina Barcode Sequencing, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/150-nucleotide paired-end illumina barcode sequencing/product/Illumina Inc
Average 90 stars, based on 1 article reviews
150-nucleotide paired-end illumina barcode sequencing - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Illumina Inc 8-nucleotide barcoded primers
8 Nucleotide Barcoded Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/8-nucleotide barcoded primers/product/Illumina Inc
Average 90 stars, based on 1 article reviews
8-nucleotide barcoded primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Illumina Inc 10-nucleotide indexing set of barcodes
10 Nucleotide Indexing Set Of Barcodes, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/10-nucleotide indexing set of barcodes/product/Illumina Inc
Average 90 stars, based on 1 article reviews
10-nucleotide indexing set of barcodes - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
StarSEQ GmbH nucleotide blast analysis of the mitochondrial dna barcoding marker gene cytochrome c oxidase i (coi)
Nucleotide Blast Analysis Of The Mitochondrial Dna Barcoding Marker Gene Cytochrome C Oxidase I (Coi), supplied by StarSEQ GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nucleotide blast analysis of the mitochondrial dna barcoding marker gene cytochrome c oxidase i (coi)/product/StarSEQ GmbH
Average 90 stars, based on 1 article reviews
nucleotide blast analysis of the mitochondrial dna barcoding marker gene cytochrome c oxidase i (coi) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

97
fluidigm nucleotides barcode tacggtagcagagacttggtct 3
Nucleotides Barcode Tacggtagcagagacttggtct 3, supplied by fluidigm, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nucleotides barcode tacggtagcagagacttggtct 3/product/fluidigm
Average 97 stars, based on 1 article reviews
nucleotides barcode tacggtagcagagacttggtct 3 - by Bioz Stars, 2026-04
97/100 stars
  Buy from Supplier

90
Biotechnology Information dna barcodes available in the national center for biotechnology information nucleotide database
Dna Barcodes Available In The National Center For Biotechnology Information Nucleotide Database, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna barcodes available in the national center for biotechnology information nucleotide database/product/Biotechnology Information
Average 90 stars, based on 1 article reviews
dna barcodes available in the national center for biotechnology information nucleotide database - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

97
fluidigm nucleotides barcode tac ggt agc aga gac ttg gtct 3ʹ
Nucleotides Barcode Tac Ggt Agc Aga Gac Ttg Gtct 3ʹ, supplied by fluidigm, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nucleotides barcode tac ggt agc aga gac ttg gtct 3ʹ/product/fluidigm
Average 97 stars, based on 1 article reviews
nucleotides barcode tac ggt agc aga gac ttg gtct 3ʹ - by Bioz Stars, 2026-04
97/100 stars
  Buy from Supplier

97
fluidigm barcode nucleotide sequences
Barcode Nucleotide Sequences, supplied by fluidigm, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/barcode nucleotide sequences/product/fluidigm
Average 97 stars, based on 1 article reviews
barcode nucleotide sequences - by Bioz Stars, 2026-04
97/100 stars
  Buy from Supplier

90
Illumina Inc sequencing adaptors with unique barcode nucleotides
Sequencing Adaptors With Unique Barcode Nucleotides, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequencing adaptors with unique barcode nucleotides/product/Illumina Inc
Average 90 stars, based on 1 article reviews
sequencing adaptors with unique barcode nucleotides - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results